| DMPK(学会誌) > 投稿される方へ > 投稿規程 | 最終掲載日: 03/11/2011 |
DMPK Instruction to Authors for Electronic Submission (PDF 53K)
Instruction to Authors
(Revised January 1, 2011)
Drug Metabolism and Pharmacokinetics is an official journal of the Japanese Society for the Study of Xenobiotics (JSSX), and itreplaces the JSSX’s former journal, Xenobiotic Metabolism and Disposition. The journal will accept original submissions in English on the understanding that the work is unpublished and is not being considered for publication elsewhere.
Scope of submitted manuscripts
Drug Metabolism and Pharmacokinetics publishes original and innovative scientific papers that address topics broadly related to xenobiotics. The term xenobiotic includes medicinal as well as environmental and agricultural chemicals and macromolecules. The journal is organized into sections as follows:
- Drug metabolism / Biotransformation
- Pharmacokinetics and pharmacodynamics
- Toxicokinetics and toxicodynamics
- Drug-drug interaction / Drug-food interaction
- Mechanism of drug absorption and disposition (including transporter)
- Drug delivery system
- Clinical pharmacy and pharmacology
- Analytical method
- Factors affecting drug metabolism and transport
- Expression of genes for drug-metabolizing enzymes and transporters
- Pharmacogenetics and pharmacogenomics
Type of manuscripts
The journal publishes Regular Articles, Notes, Short Communications, Reviews, SNP Communications, Letters to the Editors and Commentaries. With the exception of Reviews, manuscripts are reviewed anonymously by at least two independent referees, whose comments will form the basis of the final decision by the editor. Review articles are generally invited or recommended by the editorial members, and checked by one or two anonymous referees.
1. Regular Articles. New, significant, innovative, and original findings are suitable as Regular Articles.
2. Notes. Papers containing new facts and important data derived from incomplete or partial studies may be suitable as Notes. In general, the papers should not exceed 4 printed pages.
3. Short Communications. Short Communications should contain new and important information which has not been published and for which urgent publication is desirable. Short communications should be divided into the same sections as full papers, but the Results and Discussion sections may be combined at the discretion of the authors. The total length of a Short Communication may not exceed 8 double-spaced type-written pages, with each figure and table counting as one page. Short Communications should be submitted together with an explanatory statement justifying the need for urgent publication.
4. Reviews. Review articles are generally invited or recommended by the editorial members. Contemporary reviews on topics of interest covering the more recent aspects of a subject in the area of interest will be published. These may be critical reviews that present the authors' review of the current state of the subject or prospective articles intended to stimulate discussion and research.
5. SNP Communications. SNP Communications A: The aim of SNP Communications A is to distribute fairly firm information on the “new” SNPs of the genes encoding proteins related to xenobiotic metabolism and disposition. Those SNPs that have never been submitted in databases such as CYP nomenclature (http://www.cypalleles.ki.se/), arylamine N-acetyltransferase nomenclature (http://louisville.edu/medschool/pharmacology/NAT.html), transporter nomenclature (http://www.tcdb.org/, http://www.chem.qmul.ac.uk/iubmb/mtp/), Pharmacogenomics Knowledge Base (http://www.pharmgkb.org/) and Japanese SNPs (http://snp.ims.u-tokyo.ac.jp/) will be considered for SNP Communications A.
The information on SNPs need not necessarily be accompanied by functional analysis of the SNPs. However, the alteration or gene function possibly produced by the SNPs is preferred to be discussed in the text. Data on functional alteration associated with the SNPs may be submitted as a full paper. Total length of SNP Communications should be 2 to 4 double-spaced type-written pages, with a description of the location of the SNPs respect. Authors are advised to visit a Website (http://www.hgmd.cf.ac.uk/ac/index.php) for definition of numbers of nucleotides in a gene and description of nucleotide and amino acid changes. For description of the gene name of respect, accession number for it assigned by National Center for Biotechnology Information (NCBI) must be provided with the gene name given by NCBI database. Data on SNPs to be submitted should be accompanied by data on its frequency and the source of the SNPs (i.e., population etc.).
The SNPs of respect should be described together with the surrounding sequences of at least 25 base pairs with the gene name and the gene’s accession number. Authors are encouraged to give a particular number for the SNP to be submitted using the date of submission, characters related to the author’s last name and consecutive numbers for the SNP (such as “110701SatohK00I”).
Below is an example of the minimum requirement for SNP data submitted to SNP Communications A. SNP: 110701SatohK001;GENENAME:CYPXXX;ACCESSION NUMBER:NT_026015;LENGTH:101;5’_ASSAY:GGCTGCGAAGGTATTTCCATCGACCAGTGCCGGGATAGGGGGGGATCTGA;OBSERVED:C/T;3’_ASSAY:CTAATTTGTCGGGCAAGTGGCTAGTGGTGAGTTTTCTGATCGGATTGAAG
SNP Communications B: The aim of SNP Communications B is to provide information on the ethnic differences in the frequency of “known” SNPs for the genes related to xenobiotic metabolism and disposition. In this category of SNP Communications, SNPs are confined to those which have been demonstrated to cause functional alteration of proteins or genes by in vitro and/or in vivo studies, but the information on their frequencies in different ethnic populations has been limited. The frequency of SNPs is encouraged to be determined from at least 50 subjects. Total length of SNP Communications B is no more than 4 double-spaced type-written pages plus one table or figure. Manuscripts should not be divided into sections except for references.
6. Letters to the Editor. Letters to the Editor typically should address issues concerning recently published information in Drug Metabolism and Pharmacokinetics. A Letter to the Editor must reference the original source, and a Response to a Letter must reference the Letter to the Editor in the first few paragraphs. Letters to the Editor can use an arbitrary title, but a Response must cite the title of the Letter: e.g. Response to [title of Letter]
7. Commentaries. Commentaries typically highlight findings or topics appeared in Drug Metabolism and Pharmacokinetics in a wider scientific context.
Submission of manuscripts
All manuscript submissions should be made through the Manuscript Central (MC) by uploading electronic file(s) at the URL (http://mc.manuscriptcentral.com/dmpk). Submissions mailed to the editorial office will not be processed.
Authors should prepare the following electronic file(s) for each electronic submission:
In electronic submission, a file of Copyright Transfer Form (It can be found in the ‘Instruction & Forms’ tab) should be uploaded together with cover letter at “attach cover letter & copyright transfer” in page 5 of MC. Also Copyright Transfer Form may alternatively be faxed to the Editorial Office (Number +81-3-5361-7091).
Text, table(s) and figure file(s) will be automatically converted by MC into HTML and PDF documents so that they can be viewed and printed for peer reviewing. Please be sure to verify that the PDF and HTML files are satisfactory to authors before completing submission. Please note that the combined size limit for all uploaded files is 30 MB. Make sure to complete the "Files to be sent in off-line" section during the submission via MC.
The online instructions and help menus at MC (click the Get Help Now tab at the top of the page) are to be referred. “Author Quick Tutorial” and “Online Users Guide” are especially helpful.
Contact the MC Support Desks (shown below) if troubles experienced in accessing the system; the Editorial Office of Drug Metabolism and Pharmacokinetics for general questions; or questions to the office of the appropriate Editor (called Admin Center in MC) concerning the manuscript.
MC Online Submission System for Drug Metabolism and Pharmacokinetics
http://mc.manuscriptcentral.com/dmpk
MC Support Desk for Drug Metabolism and Pharmacokinetics (Japan)
Phone: +81-3-3910-4517 Fax: +81-3-3949-0230 E-mail: dmpk-mcsupport@kyorin.co.jp
Open weekdays from 9:00 A.M.-12:00/1:00 P.M.-5:00 P.M. JST (+9 GMT)
MC Support Desk for Drug Metabolism and Pharmacokinetics (International)
Phone: +1-434-817-2040 Ext. 167 E-mail: Support@ScholarOne.com
Open weekdays from 9:00 A.M.-5:30 P.M. EST (-5 GMT)
File formats
The main document should be prepared in Microsoft Word 6.0 or a later version. Files prepared in other word-processing packages should be saved in rich text format (.rtf). The recommended formats for image files are .tif, .eps, .psd, .ai, although .jpg, .gif, and .ppt are acceptable (.pptx not acceptable). BMP format should be avoided. When tables are prepared in Microsoft Excel, save each table in a file with single worksheet (multisheet Excel files are not acceptable).
Supplemental materials
Supplemental materials may be published online only. The materials are subject to the same review process as that of the manuscript. To keep supplemental material to a minimum, the maximum permitted is eight files of up to 5 MB each; with the total file size not exceeding 10 MB. The acceptable formats are Adobe PDF, .gif, .html, .jpg, and .xls and files may be compressed using ZIP compression utility. Supplemental data must be cited in the text. Once a publication is issued online, the supplemental material automatically becomes available.
Supplemental materials must be labeled with 1) the journal title, 2) the article title, and 3) article authors. The label should be placed at the top of the page. Legends should appear below figures. Text may be single spaced and put in columns for easier reading.
Authors should also state in their cover letter that they have supplied supplemental material with their manuscript. Authors are welcome to contact the Editorial Office for further details.
Organization of the manuscript for Regular Articles and Notes
Manuscripts should be typed double-spaced throughout including references, tables and figure legends. Manuscripts should contain the following sections in the order listed. Each section should begin on a new page, and all pages, excluding figure pages, should be numbered consecutively.
1. Title page. This should contain the complete title of the article, the names of all authors, and the primary laboratory of origin. Financial support for the research should be indicated as an unnumbered footnote to the title.
2. Running title page. The running title page should contain the following:
a) A running title, which conveys the sense of the full title (not to exceed 60 characters, including spaces and punctuation).
b) The name, address, telephone and fax numbers, and e-mail address of the corresponding author.
c) The number of text pages, and the number of tables and figures.
3. Summary. The abstract of about 200 words should concisely present the hypothesis being tested, general methods, results and conclusions.
4. Key Words. A list of 5-10 key words is to be listed directly below the Summary. Key words should express the precise content of the manuscripts.
5. Introduction. This section must contain a clear statement of the aims of the work or of the hypotheses being tested.
6. Methods. This section should contain explicit, concise descriptions of all new methods or procedures employed. Whereas modifications of previously published methods must be described, commonly used procedures require only a citation of the original source. Descriptions of methods must be sufficient to enable the reader to judge the accuracy, reproducibility and reliability of the experiments. The name and location (city and state or country) of commercial suppliers of the chemicals, reagents and equipment must be given.
7. Results. Contained in this section are the experimental data, with no discussion of their significance. Results are typically presented in figures or tables, with no duplication of information in the text. Magnitudes of variables reported should be expressed in numerals. Sufficient data should be presented to allow for judgment of variability and reliability of the results. Statistical probability (p) in tables, figures, and figure legends should be expressed as *p<0.05, **p<0.01, ***p<0.001.
8. Discussion. Conclusions drawn from the results presented are included in this section. Whereas speculative discussion is allowed, it must be identified as such and be based on the data presented.
9. Acknowledgments. The acknowledgment section is placed at the end of the text. Personal assistance is noted here; however, financial support is acknowledged as an unnumbered footnote to the title.
10. References. References should be typed double-spaced and numbered consecutively in the order in which they are cited in the text. Cite in the text by the appropriate Arabic numeral enclosed in parentheses, e.g., 1) or 2-5). References to personal communications, unpublished observations, and papers submitted for publication are given in parentheses at the appropriate location in the text, not in the references.
The format for journal article, chapter and book reference is as follows:
Journal article
1) Hilgendorf, C., Ahlin, G., Seithel, A., Artursson, P., Ungell, A.L. and Karlsson, J.: Expression of thirty-six drug transporter genes in human intestine, liver, kidney, and organotypic cell lines. Drug Metab. Dispos., 35: 1333-1340 (2007).
Contribution book
2) Audus, K.J., Rose, J.M., Wang, W. and Borchardt, R.T.: Brain microvesel endothelial cell culture systems. In Pardridge, W.M. (ed.): Introduction to the Blood-Brain Barrier: methodology, biology and pathology, Cambridge, Cambridge University Press, 1988, pp. 86-93.
Book
3) Chow, S.-C. and Liu, J.-P.: Design and Analysis of Bioavailability and Bioequivalence Studies. New York, Marcel Dekker, Inc., 1992.
11. Footnotes. Footnotes should be listed and presented in the following order:
a) Unnumbered footnote providing the source of the thesis information, citation of meeting abstracts where the work was previously presented in whole or in part, etc.
b) Numbered footnotes, using superscript numbers, beginning with those (if any) to authors' names and listed in order of appearance.
12. Tables. Each table must be double-spaced. The tables are numbered consecutively with Arabic numerals. A brief descriptive title is provided at the top of each table. General statements about the table follow the title in paragraph form. Footnotes to tables are referenced by italicized lower case superscript letters (a, b, c, etc.) and defined beneath the table.
13. Legends for figures. Figures are numbered consecutively with Arabic numerals, with each one displayed on a separate page. Legends must provide sufficient explanation for the reader to understand the figure independent of the text.
14. Figures. All graphics should be submitted at their actual size or larger so that it can be scaled down to fit single (84 mm) or double (176 mm) column widths without loss of resolutions. Appropriately sized numbers, letters, and symbols should be used so they are no smaller than 2 mm in size after reduction. Superscript and subscript characters are not excluded from this rule.
15. Abbreviations. All nonstandard abbreviations and acronyms should be spelled out at the point of first use in the abstract and the body of the text, followed by the abbreviations in parentheses. Thereafter, the abbreviations may be employed. Units will be in general accordance with the International Systems (SI) as adopted by the 11th General Conference on Weights and Measures.
Ethics in animal and clinical investigations
Investigations using experimental animals must state in the Methods section that the research adhered to the "Principles of Laboratory Animal Care" (NIH publication #85-23, revised 1985). Investigations with human subjects must state in the Methods section that the research followed the tenets of the Declaration of Helsinki promulgated in 1964 and was approved by the institutional human ethics committee, or equivalent, and that informed consent was obtained.
Page and illustration charges
Authors are assessed \4,000 Japanese yen per printed page. Authors will receive with their page proof a request for information concerning such charges. Charge may be modified without preliminary announcement. The cost of color illustrations will be assigned to the authors (currently \70,000 Japanese yen per page). Fifty reprints of each article (without covers) are supplied free of charge. Additional reprints are available to authors, and order forms with the current price schedule are sent with proofs.
Miscellaneous
- Revised manuscripts should be returned to the associate editor within 60 days, otherwise they will be treated as new submissions.
- The author is given an opportunity to proof the galley of an accepted manuscript. Major changes at this time are not permitted.
After acceptance
1) Please send the PDF file of the final manuscript to Editorial Office for Advance Publication. If author has not sent the copyright transfer form yet, it should be sent with the PDF file. The PDF file will not be published as an Advance Publication unless the Editorial Office receives the copyright transfer form.
2) DMPK basically publishes (print version) all the accepted articles in the order of acceptance, so please wait until being contacted for the proof-reading.
Author will receive galley proofs by an e-mail. Proofs should be printed out, corrected, and sent to Editorial office by an e-mail (dmpk-ed@imic.or.jp) or Fax (+81-3-5361-7091).
3) Please also send the Reprint Order Form (this can also be found in the ‘Instruction & Forms’ tab) after authors receive the galley proof by an e-mail or Fax.
Submission Checklist